The Janelia GAL4 collection was transferred to the BDSC as a work in progress. The lines have not been extensively verified molecularly and scientists at Janelia Research Campus estimate that as many as 5% of the stocks have the wrong insertion due to cross-contamination or misidentification. A small subset of stocks have been sequence-verified at Janelia and they are re-sending verified stocks where possible. A list of tested stocks, their test results and their status at the BDSC can be downloaded as an Excel file or a csv file.
We recommend that you establish stocks with single chromosomes from unverified lines you receive from us and check that the construct carries the appropriate gene fragment by sequencing or PCR amplification (see below).
BDSC Stk#36305 w[1118]; Dr[1] e[1]/TM3, Sb[1] can be used for re-making lines in the Janelia background.
Gene fragments in the GAL4 constructs can be PCR-verified from genomic DNA using the forward, vector-specific primer ACAAGTTTGTACAAAAAAGCAGGCT and a reverse primer specific to the relevant gene fragment (see Pfeiffer et. al., 2008). A spreadsheet containing the sequence coordinates, primer sequences used to make the gene fragment, and fragment orientation can be downloaded as an Excel file or a csv file (please note these files may contain lines not available at Bloomington).
- For sequence analysis, Janelia uses the forward, vector specific primer AAATAGGGGTTCCGCGCACAT and a reverse primer located within the Drosophila synthetic core promoter GTTTGGTATGCGTCTTGTGATTC to PCR amplify the enhancer sequence. If the GAL4 enhancer is a promoter fusion, they use the reverse GAL4 primer CGGCATCTTTATTCACATTAT. Vector-specific primer ACAAGTTTGTACAAAAAAGCAGGCT or a primer specific to the relevant gene fragment can be used for sequencing (see Pfeiffer et. al., 2008).